Model reference · open weights
BarcodeBERT is an open-weight embedding model from bioscan-ml. AxForge deploys and operates it for you on dedicated EU-owned hardware — with the licence handled where one is required.
Available as managed deployment — configured and operated for you on dedicated EU hardware, quoted per deployment.
What it is
| Released by | bioscan-ml |
|---|---|
| Type | Embedding models |
| Task | Embeddings |
| Parameters (lead) | 29M |
| Context | 512 tokens |
| Runs with | transformers |
| Released | 2024-11-13 |
| Popularity | 516 downloads / month |
| Licence | Open weights |
About
A pre-trained transformer model for inference on insect DNA barcoding data, as presented in the paper BarcodeBERT: Transformers for Biodiversity Analysis.
Code: https://github.com/bioscan-ml/BarcodeBERT
To use BarcodeBERT as a feature extractor:
from transformers import AutoTokenizer, BertForTokenClassification
# Load the tokenizer
tokenizer = AutoTokenizer.from_pretrained(
"bioscan-ml/BarcodeBERT", trust_remote_code=True
)
# Load the model
model = BertForTokenClassification.from_pretrained("bioscan-ml/BarcodeBERT", trust_remote_code=True)
# Sample sequence
dna_seq = "ACGCGCTGACGCATCAGCATACGA"
# Tokenize
input_seq = tokenizer(dna_seq, return_tensors="pt")["input_ids"]
# Pass through the model
output = model(input_seq.unsqueeze(0))["hidden_states"][-1]
# Compute Global Average Pooling
features = output.mean(1)
If you find BarcodeBERT useful in your research please consider citing:
@misc{arias2023barcodebert,
title={{BarcodeBERT}: Transformers for Biodiversity Analysis},
author={Pablo Millan Arias
and Niousha Sadjadi
and Monireh Safari
and ZeMing Gong
and Austin T. Wang
and Scott C. Lowe
and Joakim Bruslund Haurum
and Iuliia Zarubiieva
and Dirk Steinke
and Lila Kari
and Angel X. Chang
and Graham W. Taylor
},
year={2023},
eprint={2311.02401},
archivePrefix={arXiv},
primaryClass={cs.LG},
doi={10.48550/arxiv.2311.02401},
}From the published model card. Full card on the HuggingFace links in the sidebar.
Using it via the API
Once AxForge deploys barcodebert for you, it answers on the OpenAI-compatible API — the same base URL and keys as every other model. (barcodebert below is illustrative; you get the exact model name on deployment.)
$ curl -sS https://api.axforge.ai/v1/embeddings \
-H "Authorization: Bearer $AXFORGE_API_KEY" \
-H "Content-Type: application/json" \
-d '{"model":"barcodebert","input":"text to embed"}'
Create an account — your API key is available in the console. 3M free tokens every 30 days with every new account.