Model reference · open weights

BarcodeBERT

Available as managed deployment Embeddings bioscan-ml Embeddings 1 variants 516 dl/mo

BarcodeBERT is an open-weight embedding model from bioscan-ml. AxForge deploys and operates it for you on dedicated EU-owned hardware — with the licence handled where one is required.

Available as managed deployment — configured and operated for you on dedicated EU hardware, quoted per deployment.

What it is

Released bybioscan-ml
TypeEmbedding models
TaskEmbeddings
Parameters (lead)29M
Context512 tokens
Runs withtransformers
Released2024-11-13
Popularity516 downloads / month
LicenceOpen weights

About

What BarcodeBERT is

A pre-trained transformer model for inference on insect DNA barcoding data, as presented in the paper BarcodeBERT: Transformers for Biodiversity Analysis.

Code: https://github.com/bioscan-ml/BarcodeBERT

To use BarcodeBERT as a feature extractor:

from transformers import AutoTokenizer, BertForTokenClassification

# Load the tokenizer
tokenizer = AutoTokenizer.from_pretrained(
    "bioscan-ml/BarcodeBERT", trust_remote_code=True
)

# Load the model
model = BertForTokenClassification.from_pretrained("bioscan-ml/BarcodeBERT", trust_remote_code=True)

# Sample sequence
dna_seq = "ACGCGCTGACGCATCAGCATACGA"

# Tokenize
input_seq = tokenizer(dna_seq, return_tensors="pt")["input_ids"]

# Pass through the model
output = model(input_seq.unsqueeze(0))["hidden_states"][-1]

# Compute Global Average Pooling
features = output.mean(1)
Read the full model card

Citation

If you find BarcodeBERT useful in your research please consider citing:

@misc{arias2023barcodebert,
  title={{BarcodeBERT}: Transformers for Biodiversity Analysis},
  author={Pablo Millan Arias
    and Niousha Sadjadi
    and Monireh Safari
    and ZeMing Gong
    and Austin T. Wang
    and Scott C. Lowe
    and Joakim Bruslund Haurum
    and Iuliia Zarubiieva
    and Dirk Steinke
    and Lila Kari
    and Angel X. Chang
    and Graham W. Taylor
  },
  year={2023},
  eprint={2311.02401},
  archivePrefix={arXiv},
  primaryClass={cs.LG},
  doi={10.48550/arxiv.2311.02401},
}

From the published model card. Full card on the HuggingFace links in the sidebar.

Using it via the API

Call it like any OpenAI endpoint

Once AxForge deploys barcodebert for you, it answers on the OpenAI-compatible API — the same base URL and keys as every other model. (barcodebert below is illustrative; you get the exact model name on deployment.)

$ curl -sS https://api.axforge.ai/v1/embeddings \
  -H "Authorization: Bearer $AXFORGE_API_KEY" \
  -H "Content-Type: application/json" \
  -d '{"model":"barcodebert","input":"text to embed"}'

Create an account — your API key is available in the console. 3M free tokens every 30 days with every new account.

© 2026 AxForge · EU-hosted AI infrastructure Pricing Docs Trust Privacy Terms